Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene

Cited By:

Scopus
CrossRef

Except where otherwise noted, this work is licensed under Creative Commons Attribution Non Commercial 4.0 International License .

Search Relations:

Author(s):

Taghi Naserpour Farivar: [PubMed] [Scholar]
Amir Peymani: [PubMed] [Scholar]
Reza Najafipour: [PubMed] [Scholar]
Masoumeh Aslani Mehr: [PubMed] [Scholar]
Safar Ali Alizadeh: [PubMed] [Scholar]
Pouran Johari: [PubMed] [Scholar]

Article(s):

Create Citiation Alert
via Google Reader

Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene

Taghi Naserpour Farivar ^{1 , *} ,
Amir Peymani ² ,
Reza Najafipour ¹ ,
Masoumeh Aslani Mehr ¹ ,
Safar Ali Alizadeh ¹ and
Pouran Johari ¹

Authors Information

¹ Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, IR Iran

² Medical Microbiology Research Center

Article information

Biotechnology and Health Sciences: February 2017, 4 (1); e13435
Published Online: February 12, 2017
Article Type: Research Article
Received: December 29, 2016
Revised: January 17, 2017
Accepted: January 17, 2017
DOI: 10.5812/bhs.13435

To Cite: Naserpour Farivar T, Peymani A, Najafipour R, Aslani Mehr M, Alizadeh S A, et al. Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene, Biotech Health Sci. 2017 ;4(1):e13435. doi: 10.5812/bhs.13435.

Abstract

Copyright: Copyright Â© 2017, Biotechnology and Health Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

1. Background

Tremendous development of chemical industry in the past century made possible the present quality of life, but as a side effect, enormous amounts of synthetic chemicals are discharged into the environment either intentionally (as waste deposits, fertilizers, or pesticides) or accidentally. Therefore, today a remarkable number of earthbound and marine habitats are contaminated by various chemical compounds which many of them are harmful for living organisms.

Due to their impact and threat for human health, organophosphorus compounds are of great concern. Organophosphate pesticides are a heterogeneous group with a phosphoric acid derivative chemical structure. These synthetic chemicals have a cholinesterase-inhibiting activity and at the present time, organophosphate pesticides are widely used in the developing countries (1). Occupational exposure in agricultural industries and self-poisoning with organophosphate pesticides produce remarkable health problems (2–7). Exposure to organophosphate pesticides results in millions of poisoning (8–11). Organophosphate pesticides are utilized directly to the soil and can be washed off into the nearby sewerage and gullies, and consequently carry water to rivers and lakes and when these substances distributed in the environment they become polluted and require remediation (12–14). Degradation of organophosphate compounds by microbial enzymes is the focus of biodegradation researches. Organophosphate-degrading bacteria have the same organophosphate hydrolyzing enzymes. OP hydrolase is a zinc-containing protein found to hydrolyze paraoxon (15). The enzyme is encoded by an organophosphate degradation gene (opd) and can hydrolyze a variety of oxon and thion organophosphates (16, 17). The opd is reported in different taxonomic groups of soil microorganisms, which suggested its spread by transposons, plasmids, and phages as transfer vehicles (18, 19).

Previous studies suggested Pseudomonas species as competent microorganisms for microbial remediation and degradation (14, 20, 21) and within this genus, Pseudomonas plecoglossicida, which is a soil habitant, attracted much attentions (22).

2. Objectives

3. Methods

Chemicals, enzymes, and oligonucleotides: All chemical reagents including paraoxon (O,O-diethyl O-p-nitrophenyl phosphate) were obtained from Sigma-Aldrich (Tehran, Iran). Proteinase K purchased from Roche (Tehran, Iran), and synthetic dNTPs from Takapou Zist (Tehran, Iran).

Bacterial growth: Carbon-deficient medium (CSM) had the following composition: 0.2 g/L MgSO₄.7H₂O; 0.08 g/L Ca(NO₃)₂.4H₂O; 0.005 g/L FeSO₄.7H₂O; 4.8 g/L KH₂PO₄; 1.2 g/L KH₂PO₄. CSM was supplemented with an appropriate carbon source just before inoculation. Luria-Bertani medium (LB) with the following composition was used: 1.5 g/L Bacto agar; 10 5 g/L yeast extract; g/L Bacto tryptone; 10 g/L NaCl; all purchased from Difco Laboratories, Detroit, MI, USA. The pH of both mediums was 7.5.

Evaluation of biodegradation effect of modified P. plecoglossicida on paraoxon: To assess the biodegradation effect of modified P. plecoglossicida on paraoxon, the bacterial suspension was spread on CSM agar plates containing increasing concentrations of organophosphate. Paraoxon concentrations in agar were 100, 200, 300, and 400 Î¼g /mL. The plates were incubated at 37Â°C for 20 hours (23).

Degradation of organophosphate by resting cells: Degradation experiment of OP was performed as previously described by Lyer et al. (23). Briefly, 150 mL of LB medium was inoculated with transfected P. plecoglossicida on a rotary shaker at 37Â°C with 200 rpm rotation until cell density reached 1.0 at OD = 600. Cells were harvested, washed, and re-suspended in the same potassium phosphate buffer. The degradation experiment was done by mixing the cell suspension with 100 Î¼g/mL of paraoxon and incubation at 30Â°C and 120 rpm of shaking. At regular intervals aliquots were taken, centrifuged, and analyzed to remove the test compound and accumulation of its degradation products. Decomposition of organophosphate pesticides was monitored by high performance liquid chromatography under the previously described conditions (24). Briefly, the study used 25 Ã 14 mm C18 Hichrom column with 80% acetonitrile, 19.5% distilled deionized water (DDW) and 0.5% acetic acid solution as mobile phase; flow rate was 1.5 mL/minute and detection was done at absorbance 246 nm. All tests were repeated 3 times. All statistical tests were conducted by SPSS ver.14 software.

3.1. Isolation of Cellular DNA

Cetyl trimethylammonium bromide (CTAB) method was employed for total cellular DNA extraction as described before. Briefly, cells were resuspended in TE buffer, containing 50,000 Units/mL lysozyme and 300 K Units/mL ribonuclease A, and maintained for 1 hour at 37Â°C. Prior to lysis, 0.25 mg/mL of proteinase K was added and cells were lysed by application of 0.5% (w/v) sodium dodecyl sulfate (SDS) at 37Â°C for 1 hour and DNA was precipitated by standard phenol chloroform procedure.

3.2. Amplification and Insertion of Organophosphorus Hydrolase Gene Into P. plecoglossicida

Amplification of OP hydrolase gene was evaluated by polymerase chain reaction (PCR) with the following primers from parathion hydrolase gene of Flavobacterium sp. ATCC 27551; forward primer: CGCCACTTTCGATGCGAT; reverse primer: CTTCTAGACCAATCGCACTG (23). PCR program was as follows: 4.5 minutes at 94Â°C, 32 cycles at 94Â°C for 30 seconds, 55Â°C for 30seconds and 72Â°C for1 minute with a final elongation step at 72Â°C for 4 minutes. PCR products were analyzed by electrophoresis in a 0.8% agarose gel in Tris/borate/EDTA (TBE) buffer. Separated DNA fragments were excised from the gel, purified as described, and then, 1700-bp opd genes (25) were inserted into the pUC57 plasmid according to the instruction of the Template Generation System II kit (Thermo Scientific, Nedaye Fan, Tehran, Iran), and transfected to P. plecoglossicida. Briefly, 4 Î¼L of amplified opd gene DNA; 10 Î¼L of H₂O; 4 Î¼L of 5X reaction buffer; 1 Î¼L of MuA transposase, and 1 Î¼L of Entranceposonâ¢ (CamR-3) were mixed and incubated for 1 hour at 30Â°C; then, incubated at 75Â°C for 10 minutes and after that, the amplified plasmid was transformed into Stella competent cells. Presence of the plasmid in P. plecoglossicida was confirmed by amplification by the following PCR mixture: 14.4 Î¼L of H2O; 4 Î¼L of 5X Phire reaction buffer; 0.4 Î¼L of 200 Î¼M each dNTPs (10 mM each); 0.4 Î¼L of each pUC forward and reverse primers (25 Î¼M) 0.5 Î¼M; 0.4 Î¼l of Mu end primer (25 Î¼M) 0.5 Î¼M; 0.4 Î¼L of Phire Hot Start II DNA Polymerase, and 20 Î¼L of the following primer sequences:

Mu end primer: 5â-GTTTTTCGTGCGCCGCTTCA-3â; pUC reverse primer: 5â-TTATGCTTCCGGCTCGTATGTTGTGT-3â or pUC forward primer: 5â-AGCTGGCGAAAGGGGGATGTG-3â according to the following program: 98Â°C for 30 seconds, 30 cycle of 98Â°C for 5 seconds, and 72Â°C for 1 minute. A 1750-bp PCR final product indicated the presence of plasmid.

4. Results and Discussion

The bacterial strain designated as modified P. plecoglossicida was created by inserting PCR product of the amplification of opd gene of Flavobacterium sp. ATCC 27551 into the pUC57 plasmid, and transfection of P. plecoglossicida with this plasmid. Pure culturing of transfected strain in paraoxon supplemented CSM medium changes the color in the culture medium to yellow, which confirmed its ability to hydrolyze paraoxon to p-nitrophenol and di-ethylphosphate. The isolated bacteria grew on carbon-deficient agar containing 100 to 400 Î¼g/mL paraoxon as available carbon sources (Figure 1). This result suggested that the strain could degrade the organophosphate pesticides and use the products of this biodegradation.

Figure 1. Growth of Modified Pseudomonas plecoglossicida on CSM Agar Supplemented with 100 – 400 Î¼g/mL Paraoxon as the Only Available Carbon Sources

Degradation of paraoxon by modified P.plecoglossicida was started with a 100 Î¼g/mL of paraoxon. Concentration of p-nitrophenol, as a byproduct of degradation of paraoxon in the media was evaluated by absorbance at 405 nm. The effect of spontaneous OP hydrolysis was corrected by subtracting the amount of p-nitrophenol formed in the presence of Escherichia coli ATTC 25922/pUC57 cells as non-organophosphate pesticides degrading control (data not shown).

Detection of the gene in the transfected P. plecoglossicida was performed by analytical PCR with opd specific primers (23). PCR, on the whole, modified P. plecoglossicida genomic DNA, which resulted in a single amplicon for each of the F450 – R840 primers (Figure 2).

Figure 2. Detection of opd Gene in the Transfected Pseudomonas plecoglossicida by Analytical PCR Using opd Specific Primers

Chromatograms of paraoxon after 24 hours of inoculation in CSM broth containing 400 Î¼g/mL of paraoxon showed that the concentrations of paraoxon decreased after incubation with P. plecoglossicida suspension. These chromatograms showed a reverse relationship between incubation time and concentration of paraoxon in the culture tubes (Figure 3).

Figure 3. A, Paraoxon (400 Î¼g/mL) in Carbon-Deficient Minimal Medium; B, After 24 Hours Of Incubation with 0.5 mL of Modified Pseudomonas plecoglossicida Suspension (0.5 McFarland); 25 Ã 14 mm C18 Hichrom Column Was Used with 80% Acetonitrile, 19.5% DDW, and 0.5% Acetic Acid Solution as Mobile Phase; Flow Rate was 1.5 mL/min and Detection Was Done at the Wave Length of 246 nm. All tests were repeated 3 times.

Organophosphate pesticides are directly applied to the agricultural farms and can be washed off into the nearby sewerage and gullies, which are consequently carried by water to rivers and lakes and when spread in the environment they become polluted and require remediation (12–14).

The ability of transfected P. plecoglossicida to proliferate in the environment containing toxic substances by using these substances as nutrients suggests tight control over their uptake and intracellular concentration. The discovered biodegradation capabilities of transfected P. plecoglossicida may find application in a variety of tasks. The strain can be used to accelerate internalization of organophosphate pesticides in agricultural systems, sewage water, and leaks of petroleum hydrocarbons and related industrial chemicals.

Acknowledgements

Footnotes

References

1. Eddleston M, Karalliedde L, Buckley N, Fernando R, Hutchinson G, Isbister G, et al. Pesticide poisoning in the developing world–a minimum pesticides list. Lancet. 2002; 360(9340): 1163-7[PubMed]
2. Karalliedde L, Senanayake N. Organophosphorus Insecticide Poisoning. Br J Anaesth. 1989; 63(6): 736-50[DOI]
3. van der Hoek W, Konradsen F. Analysis of 8000 hospital admissions for acute poisoning in a rural area of Sri Lanka. Clin Toxicol (Phila). 2006; 44(3): 225-31[PubMed]
4. Van der Hoek W, Konradsen F, Athukorala K, Wanigadewa T. Pesticide poisoning: a major health problem in Sri Lanka. Soc Sci Med. 1998; 46(4-5): 495-504[PubMed]
5. Eddleston M, Eyer P, Worek F, Mohamed F, Senarathna L, von Meyer L, et al. Differences between organophosphorus insecticides in human self-poisoning: a prospective cohort study. Lancet. 2005; 366(9495): 1452-9[DOI][PubMed]
6. Jeyaratnam J, Lun KC, Phoon WO. Survey of acute pesticide poisoning among agricultural workers in four Asian countries. Bull World Health Organ. 1987; 65(4): 521-7[PubMed]
7. Calvert GM, Karnik J, Mehler L, Beckman J, Morrissey B, Sievert J, et al. Acute pesticide poisoning among agricultural workers in the United States, 1998-2005. Am J Ind Med. 2008; 51(12): 883-98[DOI][PubMed]
8. Buckley NA, Karalliedde L, Dawson A, Senanayake N, Eddleston M. Where is the evidence for treatments used in pesticide poisoning? Is clinical toxicology fiddling while the developing world burns? J Toxicol Clin Toxicol. 2004; 42(1): 113-6[PubMed]
9. Jeyaratnam J. Acute pesticide poisoning: a major global health problem. World Health Stat Q. 1990; 43(3): 139-44[PubMed]
10. The public health im-pact of pesticides use in agriculture. 2012;
11. Kesavachandran CN, Fareed M, Pathak MK, Bihari V, Mathur N, Srivastava AK. Adverse health effects of pesticides in agrarian populations of developing countries. Reviews of Environ-mental Contamination and Toxicology. 2009; : 33-52
12. Abo-Amer A. Biodegradation of diazinon by Serratia marcescens DI101 and its use in bioremediation of contaminated environment. J Microbiol Biotechnol. 2011; 21(1): 71-80[PubMed]
13. Arbeli Z, Fuentes CL. Accelerated biodegradation of pesticides: An overview of the phenomenon, its basis and possible solutions; and a discussion on the tropical dimension. Crop Protect. 2007; 26(12): 1733-46[DOI]
14. Geetha M, Fulekar M. Bioremediation of pesticides in surface soil treatment unit using microbial consortia. African Journal of Environmental Science and Technology. 2008; 2(2): 36-45
15. Caldwell SR, Newcomb JR, Schlecht KA, Raushel FM. Limits of diffusion in the hydrolysis of substrates by the phosphotriesterase from Pseudomonas diminuta. Biochemistry. 1991; 30(30): 7438-44[PubMed]
16. Dumas DP, Caldwell SR, Wild JR, Raushel FM. Purification and properties of the phosphotriesterase from Pseudomonas diminuta. J Biol Chem. 1989; 264(33): 19659-65[PubMed]
17. Dumas DP, Wild JR, Raushel FM. Diisoproplyfluorophosphate hydrolysis by a phosphotriesterase from Pseudomonas diminuta. Bio Technol Appl Biochem. 1989; 11: 235-43
18. Siddavattam D, Khajamohiddin S, Manavathi B, Pakala SB, Merrick M. Transposon-like organization of the plasmid-borne organophosphate degradation (opd) gene cluster found in Flavobacterium sp. Appl Environ Microbiol. 2003; 69(5): 2533-9[PubMed]
19. Somara S, Manavathi B, Tebbe CC, Siddavatam D. Localisation of identical organophosphorus pesticide degrading (opd) genes on genetically dissimilar indigenous plasmids of soil bacteria: PCR amplification, cloning and sequencing of opd gene from Flavobacterium balustinum. Indian J Exp Biol. 2002; 40(7): 774-9[PubMed]
20. Park SC, Shimamura I, Fukunaga M, Mori KI, Nakai T. Isolation of bacteriophages specific to a fish pathogen, Pseudomonas plecoglossicida, as a candidate for disease control. Appl Environ Microbiol. 2000; 66(4): 1416-22[PubMed]
21. Fulekar MH, Geetha M. Bioremediation of Chlorpyrifos by Pseudomonas aeruginosa using scale up technique. J Appl Biosci. 2008; 12: 657-60
22. CetÄ±n AK, Gur N, FÄ±rat Z. Growth rate of Scenedesmus acutus in laboratory cultures exposed to diazinon. Afr J Biotechnol. 2011; 10(34): 6540-3
23. Iyer R, Stepanov VG, Iken B. Isolation and molecular characterization of a novel <i>pseudomonas putida</i> strain capable of degrading organophosphate and aromatic compounds. Adv Biol Chem. 2013; 3(6): 564-78[DOI]
24. Borji A, Naserpour Farivar G, Johari P, Naserpour Farivar T, Senemari S, Karimi G. Cleaning From the Inside: Biodegradation of Organophosphate Pesticides by Pseudomonas plecoglossicida. Biotechnol Health Sci. 2014; 1(1)[DOI]
25. Mulbry WW, Karns JS. Parathion hydrolase specified by the Flavobacterium opd gene: relationship between the gene and protein. J Bacteriol. 1989; 171(12): 6740-6[PubMed]

Biotechnology and Health Sciences

Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene

Article information

Abstract

1. Background

2. Objectives

3. Methods

4. Results and Discussion

Acknowledgements

Footnotes

References

Connect With Us