This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.

Frequency of Chlamydia trachomatis in Endocervical Samples of Women Referred to a Gynecology Hospital in Qazvin, Iran


1 Cellular and Molecular Research Centre, Qazvin University of Medical Sciences, Qazvin, IR Iran
2 Department of Microbiology, Qazvin University of Medical Sciences, Qazvin, IR Iran
3 Department of Microbiology, Hamadan University of Medical Sciences, Hamadan, IR Iran
4 Department of Biostatics and Community Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran
*Corresponding author: Taghi Naserpour Farivar, Cellular and Molecular Research Centre, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-9128801401, E-mail: Taghin@yahoo.com.
Biotechnology and Health Sciences. 2(1): e27009 , DOI: 10.17795/bhs-27009
Article Type: Research Article; Received: Nov 10, 2014; Accepted: Jan 17, 2015; epub: Feb 21, 2015; collection: Feb 2015

Abstract


Background: Chlamydia trachomatis (C. trachomatis) is the most common bacterial sexually transmitted infection (STI). Although most genital C. trachomatis infections remain asymptomatic but infection with these bacteria is the leading cause of complications, such as pelvic inflammatory disease (PID), tubal factor infertility and abortion.

Objectives: The objective of this study was to estimate the frequency of C. trachomatis infection among symptomatic and asymptomatic women, by a polymerase chain reaction (PCR) based assay.

Patients and Methods: This was a cross-sectional study conducted over the period from May 2012 to February 2013. A total of 240 non-duplicate endocervical samples were taken from married women; endocervical swabs were collected from women referred to Qazvin Kowsar Gynecology Hospital by a training midwife. The specimens were tested for C. trachomatis by a PCR-based assay for the pha gene.

Results: Out of the 240 female participants, 184 (76.7%) were symptomatic and 56 (23.3%) were asymptomatic cases. The mean age of cases was 37.1 ± 0.9 years. Twenty (8.3%) of the 240 samples were diagnosed as Chlamydia positive according to PCR results. The prevalence of asymptomatic C. trachomatis infections was six (10.7%), while there were 14 (7.6%) in symptomatic cases. Although positive PCR results have shown in women with vaginosis (7.1%), abortion (5.1%), premature birth and low birth weight below 2.5 kg (7.7%) but the chi-square test did not indicate a significant relationship between positive PCR test results and these symptoms.

Conclusions: The results of this study showed that there was a high prevalence of C. trachomatis infection among both symptomatic and asymptomatic women. Therefore, a screening test for C. trachomatis infection is recommended for all women who refer to the genitourinary medicine clinic. Screening programs are important for cost effectiveness calculations of C. trachomatis infections especially in asymptomatic cases.

Keywords: Chlamydia trachomatis; Women; PCR; Iran

1. Background


Chlamydia trachomatis (C. trachomatis) is an obligate intra-cellular pathogen and the most frequent sexually transmitted bacterium worldwide (1-4). Most infections occur without symptoms and asymptomatic manifestation of urogenital chlamydial infection can be observed in ~30% of patients. Although effective antimicrobial therapy is available for C. trachomatis, yet undetected and untreated infections lead to diseases such as salpingitis, pelvic inflammatory disease (PID), tubal infertility and abortion (5-9). Chlamydia trachomatis in the cervix could be transmitted to a neonate during passage through an infected birth canal, resulting in neonatal pneumonia (6, 10).


The gold standard for diagnosis of C. trachomatis infection has traditionally been a culture of swab from the endocervix in women or the urethra in men (6). However, the methodological challenges of culturing of this organism and difficulty of this method have led to the development of non-culture-based tests, including antigen-detection tests and nucleic acid hybridization. These techniques however, fail to detect a substantial proportion of infections. Newer tests are accordingly required to be developed that could amplify and detect C. trachomatis-specific DNA or RNA sequences, with greater sensitivity than first generation non-culture-based tests (10-14). In many studies, the target gene for nucleic acid amplification tests (NAATs) has been the cryptic plasmid. Some studies give evidence or suggest that plasmid-free variants are present in clinical samples. Thus, infections caused by plasmid-free variants will be undetected if the plasmid is used as the target gene (12). Targets for amplification have included both cryptic plasmid (7, 8, 10, 18, 19, 22 - 24, 27) and chromosomal genes, including those for the major outer membrane protein (MOMP) (2, 11, 23, 25, 33), gyrA and phospholipase D endonuclease superfamily gene (PRPHA).

2. Objectives


The objective of this study was to estimate the frequency of C. trachomatis infection among symptomatic and asymptomatic women, by a polymerase chain reaction (PCR)-based assay using unique sequences (15).

3. Patients and Methods


This was a cross-sectional study conducted over the period from May 2012 to February 2013. During a ten-month-period, 240 endocervical samples were taken from married women, who had referred to Kowsar Gynecology Hospital Qazvin, by a training midwife. The patient’s demographic data and medical histories were collected by direct interviews and completion of the questionnaire.


3.1. Sample Collection

Briefly, cervical mucus was removed prior to insertion of a Dacron swab into the endocervical canal; the swab was then immersed in 1 mL of phosphate buffered saline (PBS) transport medium. All PBS media were maintained at 4ºC during specimen collection and then aliquoted into DNase and RNase free microtubes and frozen at -80ºC within four hours of collection until DNA extraction (16).


3.2. DNA Extraction

DNA was extracted from endocervical samples using the boiling technique by DNG PLUS (CinnaGen, Iran). The concentration of DNA samples was determined as micrograms per milliliter based on A260 values and adjusted to 1 µL/mL prior to PCR amplification. All extracted DNA were stored at -20ºC until analysis by PCR.


3.3. Detection of Chlamydia trachomatis by PCR

PCR assay was performed for detection of C. trachomatis by the pha gene. The primers were F-(5’TCTTTTTAAACCTCCGGAACCCACTT3’) and R-(5’GGATGGCATCGCATAGCATTCTTTG3’). The PCR product size was 378 bp. PCR amplification was performed in a final volume of 20 µL, containing 1 µL of each primer (10 pmol/µL, 10 µL master mix sybr green (Bioneer-USA)), 6 µL of distilled water and 2 µL of DNA samples. Sequenced C. trachomatis DNA was used as the positive control and distilled water was used as the negative control. DNA amplification was carried out with the following thermal cycling profile for pha gene; 10 minutes of initial denaturation at 95ºC followed by 35 cycles of amplification. Each cycle consisted of denaturation at 95ºC for 15 seconds, annealing at 60ºC for 30 seconds, and extension at 72ºC for 30 seconds. The PCR products were analyzed by 1.5% agarose gel electrophoresis and the product size was estimated using a 100 bp DNA ladder (Fermentas).


3.4. Statistical Analyses

Data Statistical analysis was performed using the Statistical Package for the Social Sciences software (SPSS) (version 19.0; SPSS Inc, Chicago, IL, USA). Data were summarized by frequencies and percentages for categorical variables and by means and standard deviations for normally distributed data. The relationship between results was analyzed by chi-square tests. A P value of < 0.05 was considered as statistically significant.

4. Results


The study population consisted of 240 married women; 184 (76.7%) symptomatic and 56 (23.3%) asymptomatic cases. The mean age of cases was 37.1 ± 0.9 years. During the period of this study, 240 married women with various complications were enrolled, including: 18 (7.5%) infertility, 58 (24.16%) abortion, 126 (52.5%) vaginosis (signs and symptoms included vaginal discharge, vaginal irritation and dysuria), 13 (5.4%) premature birth, 15 (6.25%) and low birth weight below 2.5 kg. Out of the 240 endocervical swab samples, 20 (8.3%) were positive for C. trachomatis by PCR of pha gene (Figure 1). Of the 56 asymptomatic women, six (10.7%) had chlamydia infection while among the 184 symptomatic cases 14 (7.6%) had this infection, according to the PCR results.


Among symptomatic women with chlamydial infection, infertility was not present in any of the cases (0%), while abortion was present in three (5.1%), vaginosis in nine (7.1%) premature birth in one (7.7%) and low birth weight in one (7.7%).


The chi-square test was used to evaluate the relationship between symptoms of genital infection using PCR. None of the symptoms such as genital discharge, dysuria, genital itching (vaginosis), abortion, premature birth, low birth weight (below 2.5 kg) and infertility showed a significant association with the infection (Table 1).


Figure 1.
Detection of Chlamydia trachomatis From Endocervical Swab Specimens by PCR Using pha Gene Primers

Table 1.
Frequency of Chlamydia trachomatis in Endocervical Specimens of Married Women According to Symptomsa

5. Discussion


Urogenital C. trachomatis infection has become a major public health problem world-wide and is one of the most frequent causes of sexually transmitted diseases (1, 2). It is a common cause of urethritis and cervicitis. Some reported sequelae include PID, abortion, tubal factor infertility, epididymitis, proctitis and reactive arthritis (5-9). The majority of chlamydia-infected individuals are asymptomatic, and remain unnoticed and untreated. Infected women may be at risk of gynaecological complications (e.g. PID and tubal infertility), and determine the reservoir for onward transmission in the population (17).


In the current study, the prevalence of C. trachomatis infection among 240 women attending Kowsar Gynecology Hospital in Qazvin was 8.3%; six cases were asymptomatic (10.7%), while 14 (7.6%) were symptomatic. The chi-square test did not show a significant relationship between positive test results and vaginosis, abortion, premature birth, low birth weight below 2.5 kg and infertility.


Torrone et al. (18) reported that the prevalence of C. trachomatis genital infection among people aged 14-39 years in the United States was 1.7%, during 2007-2012. Overall the prevalence of chlamydial infection among individuals aged 14-39 years was similar over the three National Health and Nutrition Examination Survey (NHANES) cycles combined for this analysis: 2007-2008: 1.6% (CI = 1.1-2.2%); 2009 - 2010: 1.7% (CI = 1.2-2.1%); and 2011-2012: 1.9% (CI = 1.5-2.2%). Chlamydia is the most commonly reported nationally notifiable disease, with over 1.4 million infections reported in 2012. However, case reports commonly underestimate the burden of this disease because most infections are asymptomatic and are neither diagnosed nor reported. The 2007-2012 NHANES indicated that an estimated 1.8 million people aged 14-39 years in the United States have a genital chlamydial infection. These results showed increasing rates of chlamydial infection during 2007-2012 in the USA (18). Based on several investigations, prevalence of C. trachomatis infection varies with different populations and the type and sensitivity of the detection methods used.


Marcone et al. (19) reported the prevalence of C. trachomatis infection of women in Rome. The mean prevalence of C. trachomatis endocervical infection during 2000 to 2009 was 5.2%. The results of this study showed a high rate for sexually transmitted infections (STI). Al-Thani et al. (9) reported the prevalence of C. trachomatis infection among 377 (37.9% Qataris and 62.1% non-Qataris) healthy women attending primary healthcare centers in Qatar. The specimens were tested for C. trachomatis by a PCR-based assay. Prevalence of C. trachomatis infection was 5.3% among Qatari women and 5.5% among non-Qatari women. Similar to our study, this high prevalence may reflect, in part, the limited access to and use of chlamydia screening and management (9). Araujo et al. (20) in central Brazil reported that the overall prevalence of C. trachomatis infection by PCR was 19.6%. Cuffini et al. (21) reported that the prevalence of genital C. trachomatis infection in asymptomatic women in Argentine was 13.7%. Their results showed higher prevalence of C. trachomatis infection among Latin-American women than our study.


The present study showed that C. trachomatis endocervical infection could be present in symptomatic (7.6%) as well as asymptomatic women (10.7%). The majority of chlamydia-infected individuals were asymptomatic, and remained undetected, unnoticed and untreated. Infected women may be at risk of gynecological complications (e.g. PID and tubal infertility), and determine the reservoir for onward transmission in the population. Strategies for the control of infection and prevention of its complications are only partially effective because there is no available vaccine while there is high-risk sexual behavior in the population. Screening programs have been introduced as an additional strategy for early detection and treatment of infected cases. Cost-effectiveness of screening is largely determined by the rates of complications prevented. Nucleic acid amplification methods, such as PCR, have high sensitivity, specificity and require a short duration of time for obtaining results, therefore are preferred for diagnosis of chlamydial infection.

Acknowledgments

The authors would like to sincerely thank Dr. Amir Peymani and Dr. Safar Ali Alizade for theirtechnical assistance and Dr. Hossini (Qazvin Reference laboratory) for kindly providingthe sequenced positive control for the PCR.

Footnotes

Authors’ Contributions: Study concept and design: Masoumeh Aslanimehr. Acquisition of data: Saman Saadat. Analysis and interpretation of data: Masoumeh Aslanimehr. Drafting of the manuscript: Mehry Sadeghi Ghazvini. Critical revision of the manuscript for important intellectual content: Masoumeh Aslanimehr. Statistical analysis: Amene Barikani. Administrative, technical, and material support: Taghi Naserpour Farivar. Study supervision: Masoumeh Aslanimehr.
Funding/Support: This study was funded by a grant (project number 1393-344) awarded by the Research Deputy of Qazvin University of Medical Sciences, Qazvin, Iran.

References


  • 1. Gharsallah H, Frikha-Gargouri O, Sellami H, Besbes F, Znazen A, Hammami A. Chlamydia trachomatis genovar distribution in clinical urogenital specimens from Tunisian patients: high prevalence of C. trachomatis genovar E and mixed infections. BMC Infect Dis. 2012;12:333. [DOI] [PubMed]
  • 2. Fallah F, Kazemi B, Goudarzi H, Badami N, Doostdar F, Ehteda A, et al. Detection of Chlamydia trachomatis from urine specimens by PCR in women with cervicitis. Iran J Public Heal. 2005;34(2):20-6.
  • 3. McFarland W, Abu-Raddad LJ, Mahfoud Z, DeJong J, Riedner G, Forsyth A, et al. HIV/AIDS in the Middle East and North Africa: new study methods, results, and implications for prevention and care. AIDS. 2010;24 Suppl 2:S1-4. [DOI] [PubMed]
  • 4. Akala FA, Semini I. Characterizing the HIV/AIDS epidemic in the Middle East and North Africa: time for strategic action. World Bank Publications; 2010. ISBN 821381385.
  • 5. Mardh PA. Tubal factor infertility, with special regard to chlamydial salpingitis. Curr Opin Infect Dis. 2004;17(1):49-52. [PubMed]
  • 6. Peipert JF. Clinical practice. Genital chlamydial infections. N Engl J Med. 2003;349(25):2424-30. [DOI] [PubMed]
  • 7. Gaydos CA, Theodore M, Dalesio N, Wood BJ, Quinn TC. Comparison of three nucleic acid amplification tests for detection of Chlamydia trachomatis in urine specimens. J Clin Microbiol. 2004;42(7):3041-5. [DOI] [PubMed]
  • 8. Mahony JB, Coombes BK, Chernesky MA. In: Murray PR, editor(s). Chlamydia and chlamydophila. Manual of Clinical Microbiology. Washington, DC: ASM Press; 2003.
  • 9. Al-Thani A, Abdul-Rahim H, Alabsi E, Bsaisu HN, Haddad P, Mumtaz GR, et al. Prevalence of Chlamydia trachomatis infection in the general population of women in Qatar. Sex Transm Infect. 2013;89 Suppl 3:iii57-60. [DOI] [PubMed]
  • 10. Watson EJ, Templeton A, Russell I, Paavonen J, Mardh PA, Stary A, et al. The accuracy and efficacy of screening tests for Chlamydia trachomatis: a systematic review. J Med Microbiol. 2002;51(12):1021-31. [PubMed]
  • 11. Dean D, Turingan RS, Thomann HU, Zolotova A, Rothschild J, Joseph SJ, et al. A multiplexed microfluidic PCR assay for sensitive and specific point-of-care detection of Chlamydia trachomatis. PLoS One. 2012;7(12) [DOI] [PubMed]
  • 12. Ali M, Chaudhury U, Daman S. Pcr-based detection method for chlamydia trachomatis. Google Patents; 2011.
  • 13. Ruettger A, Feige J, Slickers P, Schubert E, Morre SA, Pannekoek Y, et al. Genotyping of Chlamydia trachomatis strains from culture and clinical samples using an ompA-based DNA microarray assay. Mol Cell Probes. 2011;25(1):19-27. [DOI] [PubMed]
  • 14. Yang B, Zheng HP, Feng ZQ, Xue YH, Wu XZ, Huang JM, et al. The prevalence and distribution of Chlamydia trachomatis genotypes among sexually transmitted disease clinic patients in Guangzhou, China, 2005-2008. Jpn J Infect Dis. 2010;63(5):342-5. [PubMed]
  • 15. Niemi S, Hiltunen-Back E, Puolakkainen M. Chlamydia trachomatis genotypes and the Swedish new variant among urogenital Chlamydia trachomatis strains in Finland. Infect Dis Obstet Gynecol. 2011;2011:481890. [DOI] [PubMed]
  • 16. Airell A, Ottosson L, Bygdeman SM, Carlberg H, Lidbrink P, Ruden AK, et al. Chlamydia trachomatis PCR (Cobas Amplicor) in women: endocervical specimen transported in a specimen of urine versus endocervical and urethral specimens in 2-SP medium versus urine specimen only. Int J STD AIDS. 2000;11(10):651-8. [PubMed]
  • 17. Land JA, Van Bergen JE, Morre SA, Postma MJ. Epidemiology of Chlamydia trachomatis infection in women and the cost-effectiveness of screening. Hum Reprod Update. 2010;16(2):189-204. [DOI] [PubMed]
  • 18. Torrone E, Papp J, Weinstock H, Centers for Disease C. Prevention.. Prevalence of Chlamydia trachomatis genital infection among persons aged 14-39 years--United States, 2007-2012. MMWR Morb Mortal Wkly Rep. 2014;63(38):834-8. [PubMed]
  • 19. Marcone V, Recine N, Gallinelli C, Nicosia R, Lichtner M, Degener AM, et al. Epidemiology of Chlamydia trachomatis endocervical infection in a previously unscreened population in Rome, Italy, 2000 to 2009. Euro Surveill. 2012;17(25) [PubMed]
  • 20. Araujo RS, Guimaraes EM, Alves MF, Sakurai E, Domingos LT, Fioravante FC, et al. Prevalence and risk factors for Chlamydia trachomatis infection in adolescent females and young women in central Brazil. Eur J Clin Microbiol Infect Dis. 2006;25(6):397-400. [DOI] [PubMed]
  • 21. Cuffini C, Bottiglieri M, Kiguen X, E. Alonso C, Valdes DR, Beatriz Isa M, et al. Molecular Epidemiology of Genital Chlamydia Trachomatis Infection in Asymptomatic Adolescent-Young People. J Microbiol Res. 2012;2(4):114-7. [DOI]

Table 1.

Frequency of Chlamydia trachomatis in Endocervical Specimens of Married Women According to Symptomsa

Characteristic PCR Positive PCR Negative Total P Value
Symptomatic
Infertility 0 (0) 18 (100) 18 (100) 0.36
Abortion 3 (5.1) 55 (94.9) 58 (100) 0.55
Vaginosis 9 (7.1) 117 (92.9) 126 (100) 076
Premature birth 1 (7.7) 12 (92.3) 13 (100) 1.0
Low birth weight below 2.5 kg 1 (7.7) 12 (92.3) 13 (100) 1.0
Asymptomatic
Healthy women 6 (10.7) 50 (89.3) 56 (100)
a Data are presented as No. (%).

Figure 1.

Detection of Chlamydia trachomatis From Endocervical Swab Specimens by PCR Using pha Gene Primers
100 bp DNA ladder L2, L4: negative clinical sample; L1, L3: positive clinical sample; L5: sequenced positive control